Search This Blog

Wednesday, July 25, 2012

My Comments Censored By Dienekes' Anthropology Blog

I never enjoy commenting on censored websites, but until yesterday Dienekes had approved them all.  The following few were censored by him, however.  There was one more (a really good one, as I recall), but I didn't get that one copied for the record.  Maybe I'll remember the gist of it eventually.  I guess Dienekes avoids comments which are too challenging for him to handle.  I won't bother them anymore in the future.  There are other sources for the study of Anthropology, many which are less politically charged and biased.

http://dienekes.blogspot.com/2012/07/admixture-matters-for-polar-bears-too.html?spref=fb
shenandoah (me):  "I wouldn't call it an "evolutionary relationship"; it's more like an ~adaptation. I would only refer to it as "evolution" if their DNA actually increased in complexity in a quantifiable way."

http://dienekes.blogspot.com/2012/07/a-physico-anthropological-study-of.html?spref=fb
(This is the one for which I don't have an exact copy of my original censored post.  It should have followed Dienekes' comment, "Seriously?"  I'll try to reconstruct the gist of it from memory, when I feel more like doing so.  So frustrating and disappointing.)

This was my original published post on the same thread, to which he responded so curtly:  "That fits my theory that Neanderthals arose in Northern India... Denisovans perhaps in Southern India.

"Hindus have also been practicing both burnt sacrifices and cremation of their dead for probably since long before they discovered the use of iron and other metals.

"It makes logical sense, if they were burning "gifts" to the 'gods', that they might stumble upon such knowledge. Maybe that's how pottery and ceramics were also developed, initially. They probably thought the chemical reactions were some kind of 'magic', too."

... My point was that Neanderthals, Brachycephalics, and Metallurgy are all corelative, and I believe the Neanderthals were hybrids of Human females and Ape males.  I believe that Denisovans are another similar type of hybrid, just using a different kind of Ape.  I didn't go into much further detail than that, maybe even less detail.  I mentioned that Apes were an exotic trade commodity (as were slaves) in ancient times.  But I didn't voice my opinion that slave women were probably the breeders they used for their hybridization experiments.

'Anniemouse' then squeaked that "neanderthals have never been found in India", lol...  I doubt that many ancient humanoid remains of any kind have ever been found there -- since the Hindus have been practicing cremation of their dead, for millenia.  However, Neanderthals have been found in the Levant region, which was at one time part of the Persian empire -- which included most of India.  In fact, most of the inhabitants of the contemporary Middle East do possess Neanderthal admixture.  And another trait which I believe also corelates to Neanderthals, Brachycephalics, and Metallurgy -- Rhesus negative bloodtypes -- is also comparatively very highly concentrated in the same populations.

Other than that, I did explain that I believe most of the breeding occurred in situ, in the Apes' native environments at the time; while some of it may have also been achieved in foreign countries which had imported Apes as merchandise, aboard trade ships.

But Dienekes seems to fear the facts, so he manipulates them to support his own fantasies.

http://dienekes.blogspot.com/2012/07/r1b1a2-variants-in-1000g-data.html?spref=fb
shenandoah:  "Very good; however they don't have M269 on there (my father's).

"His surname is a rare, old English / Danish dialect hybridization, meaning "the man".  The family is reputed to trace back to the Danelaw era, and were originally from around Retford, Nottinghamshire and vicinity (Midlands England).

"Otherwise, there's a very slim chance that his particular line was Welsh instead (in that case, it means "fortress dweller").  (However, in order for that to be right, the spelling must be altered phonetically, to fit the Welsh language.)

"(Today's his birthday, btw.)"

~Maybe he just doesn't like us offspring of R1b1a2.

http://dienekes.blogspot.com/2012/07/admixture-matters.html?spref=fb
Dienekes:  "The Neandertal admixture is irrelevant to the problem of the timing of the Y-chromosome MRCA, since (a) the Y-chromosome MRCA is the common ancestor of modern human Y-chromosomes (and there is not evidence that any modern human Y chromosomes are of Neandertal origin), and (b) we don't have any Neandertal Y chromosomes to work with anyway (the genotyped Neandertal was female)."

shenandoah:  "However, there ~is a problem with the timing of the MRCA for yDNA for modern Humans, because it doesn't match up chronologically with that of the mtDNA MRCA. Right?

"Logically they should have originated together, around the same time, but they don't. That suggests to me that there is definitely Neanderthal (also Denisovan, etc.) admixture in modern yDNA.

"The origins of modern Human mtDNA are traced much further back in time, than that of modern yDNA. Modern yDNA in fact goes back to around the time of the first Neanderthals, right? I believe so.
 
"By the way, I'm not arguing against the "Adam & Eve" theory of common ancestry. I agree with that part of your comment. But yDNA was altered by ~hybridization, I believe. Of course, mtDNA was not completely unaffected, nor were the other chromosomes. They simply changed at different ~rates.

"For one example, the rash of mutations on the R clade of modern Human mtDNA roughly concurs with the yDNA timeline, except it follows behind slightly. So I believe the mtDNA changes manifested at a slower rate.
 
"It makes sense that yDNA would have been more sensitive to change through hybridization."

************************************************

So he chose to exclude these four comments (above), yet allowed two others yesterday (as follows):

shenandoah:  "Terry, just because genocide is commonplace, doesn't make it alright. It's inexcusable. And for Native Americans, it never ended. Maybe others can accept injustice, but I won't.

"As for species:  I suppose you see no difference between Horses and Donkeys either (even though they have differing numbers of chromosomes). After all, they produce 'fertile' offspring.

"A mule can breed offspring with either a donkey or a horse (just not with other mules). It just isn't done, because you wouldn't get an animal of predictable quality that way.

"Also, it's not entirely impossible for mules to produce live offspring too; it's simply more rare. Hinnys are even rarer, but it's been recorded to have happened at least once in 500 years."

... In this one, he was quite nasty toward all Native Americans, in his comments.  But especially toward me, apparently because I'm not full-blooded NA.  However, he hypocritically reveals a great deal of pride in his own Neanderthal admixture (judging from his obsession with the topic and the romantic, glorifying ways he treats it in his discussions) which nevertheless probably isn't much more than my NA genes.
 
shenandoah:  "Species: 2.A group subordinate to a genus and containing individuals agreeing in some common attributes and called by a common name.

"'Called by a common name'.  That alone should indicate that there is enough differentiation to classify them into separate special categories.

"And differing numbers of ~chromosomes is another sign of differentiation.

"Why is it a minefield? Politics?"

UPDATE:  I see now, why he chose to include these two comments and not the others -- he's got "terryt" making his same, usual, ridiculous circular arguments against these two posts, again.  Apparently, he hopes I'll fall for it and maybe slip up somehow; but really he's only shown what a complete ass he is.  Obviously, the posts he omitted are ones he can't argue against successfully.  And he doesn't like publishing any reasonable theories which don't follow his preferred script.  So he'll only publish comments which either he believes he can easily disprove, or ones with which he agrees.

http://dienekes.blogspot.com/2012/07/new-evidence-for-archaic-admixture-in.html
(In this most recent thread, Dienekes again rudely and angrily attacks a commenter for thinking outside of the box, and for daring to share his thoughts concerning Human origins which are counter to Dienekes own pet theory.  And theories these are, because nothing has as yet been proven.  But Dienekes is quite impolite and temperamental with people who don't go along with his program.  I don't get the sense that Dienekes is seeking truth, that much.  More like a fantasy wish-fullfillment.)

*************************************************************
There is a definite pattern of "identity politics" on that blogsite (which you might think would at least attempt to exhibit objectivity, since Anthropology is supposedly a science topic).  Dienekes is very much anti-Native American and very biased about the subject of our origins and unique characteristics, like most government funded geneticists.

He doesn't think people like myself, whose gg-grandparents were Indian, should consider ourselves Native American.  We should pretend those particular ancestors didn't exist, I suppose.  He thinks we should accept the labels which he, geneticists, and the government place upon us.  And he doesn't seem to understand the concept of having more than one ethnic identity within the same person.

He hypocritically allows many comments which demean Native American oral histories, which is how all tribes without written languages record them.  He calls it "myth", as if all Native American legends are nothing more than lies, yet gets all warm and fuzzy over Greek mythology (which like the Native American variety began orally, being written down later), even pointing out certain 'truths' which he finds in the Iliad, etc.

When Europeans first invaded the American continents, they pounced on the Natives' lack of written languages as a trait of "savages" or "barbarians", making them inferior to people who write on paper (remember, Native Americans did write on stone, in many cases).  That's why Sequoyah developed the Cherokee alphabet for his people.  And for many decades, thanks to him, the Cherokee had their own language newspaper (and probably bibles and other books, as well).

The point is, these scientists and governments would have us believe that without written and officially recorded documentation, our histories are nonexistent.  That's wrong.

http://dienekes.blogspot.com/2012/07/the-social-network-of-iliad-is-highly.html
(..."realistic".)
Similarly, he tries to downplay and minimize Neanderthal, Denisovan and other Hybrid, interspecies admixtures of Humans.  He suggests that Neanderthals, et al, were "cousins" of Human beings, rather than separate species.  In truth, they were sub-species of Humans (the same way that Mules are sub-species of Horses and Donkeys).  I guess it safe to assume he has quite a bit of Neanderthal in his own genome.  He's very defensive about the subject.

From Racism to Genocide, Anthropology in the Third Reich, by Gretchen E. Schafft, published by the University of Illinois Press.

'Astounding new information about the role of anthropologists in Hitler's efforts to create a "master race"

'From Racism to Genocide is an explosive, richly detailed account of how Nazi anthropologists justified racism, developed practical applications of racist theory, and eventually participated in every phase of the Holocaust.

'Using original sources and previously unpublished documentation, Gretchen E. Schafft shows the total range of anti-human activity from within the confines of a particular discipline. Based on seven years of archival research in this country and abroad, the work includes many original photos and documents, most of which have never before been published. It uses primary data and original texts whenever possible, including correspondence written by perpetrators. Her discussions of Hitler's "final solution," Nazi slave labor, and the rape of occupied Poland evoke the full horror of the Third Reich. The concepts embedded throughout the book of "scientism," "denial," "academic responsibility," and "race" contribute to understanding some of today's most pressing social science issues.

'The book also reveals that the United States was not merely a bystander in this research, but instead contributed professional and financial support to early racial research that continued through the first five years of Hitler's regime.

'This is a heartfelt plea for anthropologists to recognize the dehumanizing, and sometimes even murderous, consequences of their pursuit of "science" and to be sure that, in the future, the quest for knowledge does not compromise the humanity of research 'subjects'.'"--Journal of Modern History'

I would only add that Hitler and the US at that time manipulated facts, practiced bias and prejudice, and distorted interpretation of data, in order to falsely 'prove' themselves to be members of the "master race"; the same things which scientists and the government continue to do in the present day, regarding Native Americans and Neanderthals, Denisovans, etc.  They're attempting to make Native Americans disappear forever with bogus legal and technical definitions, while glorifying and even romanticizing Neanderthals and other sub-Human hybrids.

No matter how much Native American admixture you actually have, they vehemently deny and minimize it, using false science and bogus tribal blood quantum laws to "prove" their cases against us; yet they're very proud of their Neanderthal admixture, no matter how little they may have.

And it would be a grave mistake to disregard any of those types of admixtures, regardless of how small the "percentages" may be.

Most of the more outspoken and fanatical online "Anthropologists" (including Andrew Auernheimer) whom I've encountered, are extremely racist and narcissistic. Auernheimer is a Nazi, too. It's looking now like Dienekes is also.

*******************************************************

http://dienekes.blogspot.com/2012/07/major-new-ancient-dna-project-on.html
shenandoah:  "If that's the case, any ~racially mixed person is a 'hybrid' by your definition".

Terry (terryt): 'Yes.'

shenandoah:  "hy·brid (hbrd)
"n.
"1. Genetics The offspring of genetically dissimilar parents or stock, especially the offspring produced by breeding plants or animals of different varieties, species, or races.

"So what you're doing is emphasizing the loosest and broadest definition of the term, by down-playing the "species" aspect of the definition.

"Whereas, I find that aspect to be the most definitive and accurate of all. Because, it better serves to distinguish real ~subspecies from diverse parental stock.

"A blend of different breeds (races) within a species, is not a ~subspecies. Yet Anthropologically speaking, Neanderthals and Denisovans ~are subspecies of Humans. (Just to get us back on topic).

"To me, the question of ~species is more interesting and germaine than that of race."

(Note:  "terryt" has not denied my allegation that he is in fact Dienekes' internet forum sock-puppet.  He side-stepped the issue when I questioned him, following my suspicions.  And his mission seems to have been two-fold:  blur the definition of "hybrid"; and deny that my gg-grandmother was full-blooded Native American, in other words -- deny that my own mtDNA is Native American.)

(Note:  "terryt" -- aka Dienekes Pontikos -- is still prattling on over there, lecturing me with gibberish, as if I'm still in the conversation.)

http://en.wikipedia.org/wiki/Homo_(genus)
Even Wikipedia distinguishes the various types of Homo genus ~species.  According to this article, the genus is Homo; the various species are listed there as follows:  sapiens (ie true Human type), gautengensis, habilis, erectus, antecessor, ergaster, heidelbergensis, neanderthalensis, floresiensis.

It's quite obvious to me (and has been for some time now), that most of these supposed internet 'scientists' (especially the more vocal ones who are enamored of their own Neanderthal ancestry) know absolutely nothing about biological scientific classification.  Pathetic.

http://erectuswalksamongst.us/
Richard D. Fuerle, c2008 Spooner Press, NY
http://erectuswalksamongst.us/Chap25.html
Interesting theory; however, it's wrong.  Not convincing at all.  My theory is more plausible and is undoubtedly the correct one.  This guy has a lot of money to spend (or, waste) collecting college degrees, yet he's proof that a degree is no guarantee that a person is truly educated.  Another red flag here, is that with all his many degrees (which must have cost a mint), he works as a lawyer... which is like saying "he works as a professional liar".

************************************************

In summation, it appears that even the slightest suggestion or the merest implication that they (who have long established themselves the "elite", entitled, 'master' race -- mostly through brute violence and malignant greed) might in reality themselves possess "the monkey blood" after all, causes the Hybrid types to squirm violently and roar loudly.  If that's true, as I believe it is, it would quickly flip their hierarchical social status quo upside down.  How ironic.

************************************************

Much as I tried, I couldn't resist replying to this thread:

http://dienekes.blogspot.com/2012/08/morphometric-analysis-of-zuttiyeh.html

"...appear very much like a serious of experiments that lead in some vague way to something akin to us."  "...experiments..."

The available data doesn't make Human origins look anything like the product of "evolution" at all; instead it looks more like what I believe it was and what you have just admitted: breeding "experiments".
 

But you all keep trying to manipulate the data so that it fits your preconceived Theory.  (Same thing you do with Native American data.)

UPDATE: He didn't publish this one, either (lol).

**************************************************

Another update:  Since around the time "terryt" started harassing me over here (making the same arguments -- about hybridization, and denying my own Native American mtDNA -- both on Dienekes' and my own blog), and Dienekes said "Seriously?" and stopped publishing most of my comments on his Anthropology blog (except for the ones on which terryt continued to argue circuituously and repetitively about -- you guessed it: hybridization and my own mtDNA)...
 

... I've been informed that "social engineers" types of websites have been checking in over here multiple times daily (many times more frequently than any other sources of views).  These are places where trolls hang out.  They can't get real jobs, but they own personal computers, so they try to make money being hired mercenaries, or as I would call them: internet bullies.
 

These are a few of the sites which have shown more than the normal amount of interest in my blog, lately:


These are only two of them; I know of at least a couple more... I'll try to add the links when I find them.  Ok, here they are:


That's not even all of them, because I definitely remember seeing one in the Turkish language and at least one or two in Spanish.  Possibly German and French, too (if I remember correctly).

&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&&

Other good Anthropology, Genetics, History and Genealogy websites:

(German Dziebel's own website.  Published author of two serious books on the subject of Human origins... Dienekes' was/is extremely rude to this guy, as he was/is to me and others.)
(Here, he lists several possible hypotheses of Human origins, for comparison.)
(Interesting discussion about the Indo-Europeans.)
(Wow!!!  He has a problem with Dienekes, too!  Go figure...  Seems Dienekes is playing politics with both, Indo-European and Native American origins.  I would add that he's performing the same kind of ruse with Neanderthal and Denisovan data.)

(Dziebel's book in the Russian language, full text... Maybe I can talk my daughter into reading it for me, and then writing a full report on it, lol.)
(His English language book, which must be quite popular, since it's quite expensive and seems to be sold out, too.)

(Another of Dziebel's websites, I think; a very interesting one, at that.)
(Another Dzieble site; damn, he's deeeeep, lol!)

(Scientific Research, open access; lots of research papers here.)

Neanderthal research (and that of Human origins) all seems to hinge on the B006 haplogroup, which is evidently X-linked.  Hmm.  So fascinating.  I feel the answer is right in front of us, but we're all still trying to put the pieces of the puzzle together.  I don't doubt that the full truth might shock a lot of people.  German Dziebel seems a much deeper thinker than most.  He seems to really be searching for truth, while the rest seem mostly government lapdogs or racial supremists.  I just hope I have the time and resources to finally figure it all out for myself; curiosity is killin' me!

I'm just afraid that Mankind might ironically succeed in destroying itself before they are ever able to figure out who and what we truly are.  Who are we; what are we?  Who and what is a real Human being?  Intuitively, I already know the answer, but I want to see science prove it out... I want to see justice done, for all who have died senselessly in all the nauseatingly endless tribal, religious and racial wars -- all the genocides.

...I respect Dziebel for using his real name online and for his comment policy on his blog.  I think online anonymity is shameful, and never should have become customary.  I wish that every person commenting online would be required to use their REAL NAMES.  That would restrict criminal behaviors of every type, and I don't believe it would cause any real danger to users of the web.  We have no privacy anyway (~criminals, whether in or out of government offices, have access to our data regardless), so we have no need to protect it anymore.

I also like that (unlike Dienekes Pontikos -- which I'm sure is NOT his real name) Dziebel lists his very impressive credentials, in detail.

(His comment policy.)
(His credentials.)
(Re: the "Out of America" theory of Human origins... which I might add, I've considered a possibility myself.)
("A Russian born scholar named German Dziebel has proposed something similar.
German Dziebel specials in a multi-disciplinary approach to anthropology and linguistics.
He says in effect that haplogroups C and Q are twin brother groups from the same source and that other groups are later developments.
Haplogroups C and Q are both found together in the same Na-Dene populations. The Na-Dene are an Amerindian linguistic group found in A|aska, Western Canada, and in the south including the Navajo and Apaches. It is related to some of the native languages of Siberia.
Conventional science puts Q and C as being very distant from each other, C being what is considered an early type and Q one of the latest.
German Dziebel says that in effect Q is a direct offshoot of C without having passed through any intermediate stages.
This corresponds with the Brit-Am outlook since R is close to Q and we propose that R was a very early development with groups evolving (through simplification) from it rather than it evolving from them.
Conventional science puts Q and R as both offshoots of P and the latest to evolve whereas C is considered amongst the earliest.

The understanding of German Dziebel in our opinion is not that far from that of Brit-Am.
This was brought to our attention by an e-mail of Cristian Sildan shown below..."

"Y chromosome (transmitted only be males) DNA haplogroups as explained by conventional science give a progression in alphabetical order.
ABCDEFG...PQR etc.
A is the simplest, R one of the most complicated ergo R evolved from A.

"Brit-Am reverses the procession and says that R could just have easily have been the first and others evolved from it by a simple process of simplification, of discarding superfluous information.")

This makes soooo much better sense to me, too.  My dad's yDNA is supposedly R1b1a2, and I couldn't understand how he could have come from such an ancient European lineage, which I presume to have been probably indigenous to Europe, or at least very, very early - if his yDNA was really the most recently evolved.  That always puzzled me.)

(Very interesting conversation.)

(I find that most Zionists - especially Jewish Zionists - really hate America, Americans and Christians; despite all the support we have given them and continue to do so... They bite the hand that feeds them, the hypocrites.)
("We may redirect this observation to answer Ronald Coase’s dilemma, namely why there are companies and corporations in the first place instead of just networks of self-employed and mutually contracting individuals.")

"... the blog is not a simple advocacy for an Out-of-America theory but a holistic anthropological critique of Eurocentric, Old World-centric, reductionist, positivist, vulgar materialistic and monodisciplinary approaches to the origin of modern human anatomy, behavior, language and culture. It's my contention that the mainstream science of human origins is driven not only by theory building and data accumulation but also by cultural stereotypes rooted in pre-scientific worldviews. The secondary nature of American Indian populations compared to Old World populations and the recency of human occupation of the Americas is one such stereotype. Correspondingly, the wide-spread belief in the supreme antiquity of Bushmen and Pygmies in Africa is another stereotype. I first sketched out an "Out-of-America" theory of human origins in my two books (the first one was published in Russian, the second one in English) devoted to the phenomenon of human kinship and the global diversity of kinship terminologies."

(Awesome essay; he sees the whole picture.  Guess that's why he calls his technique of analysis, "holistic".)

I can see that I'm going to have a hell of a time keeping up with his blog, but I dearly hope that I may have time to read through all of it.  I want his book too, lol.

http://www.forumbiodiversity.com/showthread.php/36050-Can-Dienekes-Pontikos-still-be-regarded-as-a-useful-source-of-info

Today (Dec. 18, 2012), I asked Dienekes Pontikos if that is his real name.  I'm serious too; I don't really believe that it is.

http://s1.zetaboards.com/anthroscape/topic/4107532/1/
People wondering who the hell he really is.  Many posting here can see he is overtly biased, as I do.
http://www.nature.com/news/2010/101215/full/468880a.html
According to this article in Nature, Dienekes Pontikos is a "pseudonym".  And, that he is a "hobbyist" and a self-described "anthropology dilettante".  So the question remains: who is he?  He has way too much influence to remain anonymous, in my opinion.

UPDATE: (Dec. 20, 2012) Ok, it's official now -- "Dienekes Pontikos" ignored my question about his real identity, which I posted on this blog post:

http://dienekes.blogspot.com/2012/12/genographic-genochip-paper-elhaik-et-al.html

What triggered my response, was his quote, "By the way, thanks to the authors for putting me in the acknowledgements section :)".

While ignoring my questions about his true identity, he went ahead and later posted another, more banal comment by "eurologist".

My comment was very polite, too; I simply remarked that maybe I owe him an apology for not believing that was his real name.  And, I asked him point-blank, if that is the name on his original birth certificate... but once again, not a peep out of him.  He has no problem pushing his political agendas, though, at every opportunity.

http://dienekes.blogspot.com/2009/01/more-on-lebanese-phoenicians-or-mixing.html
http://dienekes.blogspot.com/2009/07/intermarriage-and-risk-of-divorce-in.html
http://dienekes.blogspot.com/2012/07/reconstructing-origin-of-native.html
http://dienekes.blogspot.com/2012/07/petty-identity-politics-indeed-or.html

So, I take it the authors of that 'scientific paper' gave acknowledgement to a "researcher" who publishes under a pseudonym.

http://dienekes.blogspot.com/2013/01/mating-between-modern-humans.html
UPDATE:  I finally managed to break through to them, with a comment regarding the subject matter at hand (Human Hybrid theory); however, it drew the attention of the more sexually immature participants ("terryt" -- what a surprise -- and "Roy", there's another puerile, homo troll for you).  I gather from life experience that most men, whether straight or gay, are exceptionally juvenile regarding the subject of anything even vaguely sexual.  Of course, a lot of women are too... but thank God I don't date females, or hermaphrodites for that matter.

Thursday, July 19, 2012

Fasta File

>XXXXXX,HVR2,CR,HVR1

GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGC

GATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTA

TCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA

ACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCAAACCCCCCCTCCCCCGCTTC

TGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTT

TATCTTTTGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAAT

CTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCCC

AAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCC

ATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGAGT

TCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCAC

ACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTC

AATTTCGTGCCAGCCACCGCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCC

TCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACAT

ATCTGAACACACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATC

AACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGAGG

AGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATACCGCCATCTTCAGCAAACCC

TGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATG

GGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAG

AGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCCTCAAGTATACTTCAAAGGACAT

TTAACTAAAACCCCTACGCATTTATATAGAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAA

CCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCTA

GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGCGATAGAAATTG

AAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCC

TATACCTTCTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAGCT

ACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTAC

CGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCT

TGTAAATTTAACTGTTAGTCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATTTA

ACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAAC

ATATAACTGAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAA

ACATTCTCCTCCGCATAAGCCTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCAAC

AAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAAAAAAAGTAAAAGGAACTCGGCA

AATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATG

TTTAACGGCCGCGGTACCCTAACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC

ACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGGCGGGCATAACACAGCAAGACGA

GAAGACCCTATGGAGCTTTAATTTATTAATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATT

AAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCGAA

CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCTATTCTAGAGT

CCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTG

TTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTANCTTCAAATTCCTCC

CTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATT

ATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCA

GAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCA

TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCT

ACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACA

TCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTC

AACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTC

AAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTAT

CAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCA

TGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTC

CGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTA

TTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACATAT

TTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCTACGACCAACT

CATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTAGCATTACTTATATGATATGTCTCCATACCCATTACAATCT

CCAGCATTCCCCCTCAAACCTAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCC

CCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTA

AAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCT

GGCCCAACCCGTCATCTACTCTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTGAG

TAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTCGTTCCACAGAAGCTGCCATC

AAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATG

AACCATAACCAATACTACCAATCAATACTCATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCCCT

TTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCTTCTCACATGACAAAAACTAGCC

CCCATCTCAATCATATACCAAATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGC

AGGCAGTTGAGGTGGATTAAACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAA

TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCCTAACTACTACCGCATTCCTA

CTACTCAACTTAAACTCCAGCACCACGACCCTACTACTATCTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAAT

TCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATTCA

CAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCTCTACTTCTACCTACGCCTAATC

TACTCCACCTCAATCACACTACTCCCCATATCTAACAACGTAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCC

ATTCCTCCCCACACTCATCGCCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTTA

GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGTAACAGCTAAGGACTGCAAAA

CCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCA

CAAACACTTAGTTAACAGCTAAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAAAAGGCGGGAG

AAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCTCGGAGCTGGTAAAAAGAGGCC

TAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACTCAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTG

ACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTC

TAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACA

GCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAAT

AATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGC

TCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCT

GGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCAC

AACAATTATCAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAG

TCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTC

TTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCT

TATCCTACCAGGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTA

TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTA

GACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCAC

ACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCC

TGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACGTTGTAGCCCACTTCCACTAT

GTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGA

CCAAACCTACGCCAAAATCCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCC

TATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGCTCATTC

ATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGA

AGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAAT

CTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCCTCCATGACTTTTTCAAAAAG

GTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCG

CAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTT

CCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTC

AGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTAC

ATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGA

CTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTG

ACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTC

CCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATA

CTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCT

TTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAAC

CTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCAT

AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTACCTCCCTCAC

CAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCC

CCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATC

AACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGATAACCATACACAACACTAAAGG

ACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCAT

TTACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTCGC

TCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGA

AACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGC

ACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTA

CTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAA

CACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCT

CCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACAC

TAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGC

CTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAG

CCTAGCCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCC

TAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAATAGAAAACAACCGAAACCAA

ATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCC

CTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCT

CAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCC

GCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAG

TATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTAA

TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACATAGAAAAATCC

ACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTAC

CTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAG

TTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACC

GAATTGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCAT

TTACATAAATATTATACTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTAC

TATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAAT

ATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACAC

ATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCACT

GACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACAGCCTAATTATTAGCATCATCCCTCTACTAT

TTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCCAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATA

CTAACTACCTGACTCCTACCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACT

CTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCT

TCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACA

TACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCACT

AAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTTAATATGACTAGCTTACACAA

TAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTTATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGG

TCAATAGTACTTGCCGCAGTACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGAC

AAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAG

ACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGA

AGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTA

CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTC

TAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCC

TGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAAC

ACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACC

TATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACA

TCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCC

CATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCA

ACTCCAAATAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCA

CCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTCTC

TTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCA

GCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATATTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAG

AATTCTCACTGTGATATATAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCATA

CTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCAT

CAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTT

TCATCCTCGCCTTAGCATGATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCCA

AGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTC

AGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCC

GCTTCCACCCCCTAGCAGAAAATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCA

GCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAAGTCAACTAGGACTCATAATAGT

TACAATCGGCATCAACCAACCACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGT

GCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTC

ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGTTTCTACTCCAAAGACCACAT

CATCGAAACCGCAAACATATCATACACAAACGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCT

ATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCC

ACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAACATTTCCCCCGC

ATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACTCACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCC

TAGACCTCAACTACCTAACCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATTC

TACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACCT

AACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAG

GCATAATTAAACTTTACTTCCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACCTATTCCCCCG

AGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAACTACTACTAATCAACGCCCATAATCATACA

AAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTA

AAGTTTACCACAACCACCACCCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAAC

ACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGCTGTAGTATATCCAAAGACAA

CCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAATAACACACCCG

ACCACACCGCTAACAATCAATACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAA

ACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGACCAATGATATGAAAAACCATC

GTTGTATTTCAACTACAAGAACACCAATGACCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTC

ATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAAT

CACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCACATCACTCGAG

ACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATC

GGGCGAGGCCTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGC

AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCG

CCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTC

TTTACCTTTCACTTCATCTTGCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGATC

AAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCT

TACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTA

GCCAACCCCTTAAACACCCCTCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCC

TAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCCCATCCTCCATATATCCAAAC

AACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATC

GGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCT

AATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTATAAACTAATACACCAGTCTTG

TAAACCGGAGATGAAAACCTTTTTCCAAGGACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAG

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACA

ACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACA

TAAAAACCCAATCCACATCAAAACCCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCA

ACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATATCAACAAACCTACCTACTCTTAACAGTACATAGTACATAAAGC

CATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGAC

CACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTA

AAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGAC

ATCACGATG