Search This Blog

Tuesday, January 17, 2012

My mtDNA BLAST against the Standard Human Genome Sequences

The entire page of data, from my DNA BLAST against the standard "Human" comparison model:

BLASTN 2.2.26+Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14.

RID: HCSNX8TJ012

Database: Homo sapiens build 37.3 genome database (reference assembly
GRCh37.p5 [GCF_000001405.17] and alternate assemblies HuRef
[GCF_000002125.1] and CRA_TCAGchr7v2 [GCF_000002135.2])
           4,900 sequences; 5,937,867,303 total letters
Query=
Length=569

Sequences producing significant alignments: .........................Score (Bits) .........E Value

ref|NC_012920.1| Homo sapiens mitochondrion, complete genome 1018 0.0 
ref|NT_024862.14| Homo sapiens chromosome 17 genomic contig, ... 283 3e-75
ref|NT_022135.16| Homo sapiens chromosome 2 genomic contig, G... 169 1e-40 ref|NW_001838859.2| Homo sapiens chromosome 2 genomic contig,... 169 1e-40 ref|NT_011786.16| Homo sapiens chromosome X genomic contig, G... 158 2e-37 ref|NW_001842398.1| Homo sapiens chromosome X genomic contig,... 158 2e-37 ref|NT_006576.16| Homo sapiens chromosome 5 genomic contig, G... 150 4e-35 ref|NW_001838927.1| Homo sapiens chromosome 5 genomic contig,... 150 4e-35 ref|NT_167190.1| Homo sapiens chromosome 11 genomic contig, G... 139 8e-32 ref|NW_001838024.1| Homo sapiens chromosome 11 genomic contig... 139 8e-32 ref|NT_016354.19| Homo sapiens chromosome 4 genomic contig, G... 121 3e-26 ref|NW_001838915.1| Homo sapiens chromosome 4 genomic contig,... 121 3e-26 ref|NT_006051.18| Homo sapiens chromosome 4 genomic contig, G... 111 2e-23 ref|NW_001838897.1| Homo sapiens chromosome 4 genomic contig,... 111 2e-23 ref|NW_001838021.1| Homo sapiens chromosome 11 genomic contig... 80.5 5e-14

ALIGNMENTS>ref|NC_012920.1| Homo sapiens mitochondrion,
complete genome Length=16569

Score = 1018 bits (551), Expect = 0.0
Identities = 563/569 (99%), Gaps = 0/569 (0%)
Strand=Plus/Plus

Query1
ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16001 ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAG 16060

Query 61 TATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16061 TATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAA 16120

Query 121 TATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16121 TATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCA 16180

Query 181 AAACCCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCA 240 |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 16181 AAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCA 16240

Query 241 ACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATATCAACAAACCTACCTACTCTTAA 300 ||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||| Sbjct 16241 ACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAA 16300

Query 301 CAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16301 CAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTC 16360

Query 361 GTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16361 GTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCA 16420

Query 421 ATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 16421 ATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTA 16480

Query 481 AAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCAC 540 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 16481 AAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCAC 16540

Query 541
ACGTTCCCCTTAAATAAGACATCACGATG 569 ||||||||||||||||||||||||||||| Sbjct 16541 ACGTTCCCCTTAAATAAGACATCACGATG 16569

>ref|NT_024862.14| Homo sapiens chromosome 17 genomic contig, GRCh37.p5
Primary Assembly Length=596398

Features flanking this part of subject sequence: 2662 bp at 3' side: humanin-like protein 1

Score = 283 bits (153), Expect = 3e-75
Identities = 455/594 (77%), Gaps = 48/594 (8%)
Strand=Plus/Plus

Query 1
ATTCTAATTTAAACTATTCTCTGTTCTT-TCATG-GGGAAG-CAGATTTGGGTACCACCC 57 |||||||||||||||| |||||| | || ||||| ||| || || ||||||||| ||||
Sbjct 353548
ATTCTAATTTAAACTACTCTCTG-TATTCTCATGAGGG-AGCCA-TTTTGGGTACAACCC 353604

Query 58
AAGTATTGACTCA-CCCATCAACAACCGCTATGTATTTCGT-ACATTACTGCCAGCCACC 115 |||||| ||| || |||| | | || ||| ||| |||| | ||| |||| |||||||
Sbjct 353605
AAGTATCGACCCACCCCA-CCATAA-TTTTATATATATCGTGA-ATTTCTGCTAGCCACC 353661

Query 116
ATGAATATTGTACGGTACCATAAATACTTGAC--CACCTGTAGTACATA-AAAACCCAA- 171 ||||||||| || |||| |||| | ||| || | | ||||||||| |||| ||
Sbjct 353662
ATGAATATTATATAGTACTATAATTGCTTAACTGTA-C-ATAGTACATATCAAACGAAAC 353719

Query 172
TCCACATCAAAACCCCCCCCCCATGCTTACAAGCAAGTAC-AGCAATCAACCTTCAACT- 229 || ||| ||| || |||| | | ||||||||||||| || || ||| ||||| ||||
Sbjct 353720
TCAACAACAACTCCTCCCCACGACGCTTACAAGCAAGGACTAG-AAT--ACCTT-AACTA 353775

Query 230
A---TCACACA-TCAACTGCA-ACTCC-AAAGCCACCCCTCACCCACTAG-GATATCAAC 282 | | ||||| | ||| || |||| |||| || |||| |||| || | || |||
Sbjct 353776
ACGGTAACACATTAAAC-CCACCCTCCAAAAGAAACTTCTCAACCACAAGCG-TACCAAA 353833

Query 283
AAAC-CTACCTACT-CTTAACAGTACATAGTACAT-AAAGCCATTTACCGTACATAGCAC 339 |||| ||| || | ||| |||||||||||||| || | | | ||| |||||||
Sbjct 353834
AAACACTATATA-TCCTT--GAGTACATAGTACATCTAA-TCGCTCATGGTAGATAGCAC 353889

Query 340
ATTACAGTCAAATC-CCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTG 398 ||| |||| ||| | | |||||| | |||| | ||||||||||||| ||||| |||
Sbjct 353890
ATTCCAGTTAAA-CAAGTCCTCGTCAATACGGAT-ATCCCCCTCAGATAGTGGTCCGTTG 353947

Query 399 ACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGC 458 |||||||||| ||||||||||||||| ||| |||||||||||||| || | ||| ||
Sbjct 353948 TTCACCATCCTCTGTGAAATCAATATCCTGCAGAAGAGTGCTACTCTTCTTGATCCAGGT 354007

Query 459
CCATAACACTTGGGGGTAGCTA-AAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGG 517 |||||| ||||||||||||||| || ||||||||||||| ||||| |||| ||| |||
Sbjct 354008
CCATAATACTTGGGGGTAGCTATAA-TGAACTGTATCCGGCATCTTGTTCTTACCTCACA 354066

Query 518
GCCATAAAGCCTAAATAGC--CCACACGTTCCCCTTAAATAAGACATCACGATG 569 ||||||||| | || | | |||||||||||||||||||||||||||||||||
Sbjct 354067
GCCATAAAG--TCAAGACCAACCACACGTTCCCCTTAAATAAGACATCACGATG 354118

>ref|NT_022135.16| Homo sapiens chromosome 2 genomic contig, GRCh37.p5
Primary Assembly Length=39439245

Features flanking this part of subject sequence: 103481 bp at 5' side: kynureninase isoform b 62876 bp at 3' side: rho GTPase-activating protein 15

Score = 169 bits (91), Expect = 1e-40
Identities = 220/279 (79%), Gaps = 21/279 (8%)
Strand=Plus/Minus

Query 296
CTTAACAGTACATAGTACATAAAGCCA-TTT-ACCGTACATAGCACATTACAGTCAAATC 353 ||||| | ||||||||||||||| | ||| | || |||||||||||| ||||||||
Sbjct 33598847
CTTAATATTACATAGTACATAAA---ATTTTCATCGAACATAGCACATTTCAGTCAAAAA 33598791

Query 354
CCTTCTCGTCCCCATGGATGA-CCCC-CCTCAGATAGGGGTCCCTTGA-CCACCATCCTC 410 | || ||| |||| || | |||| || || || |||| ||| | | |||| ||||
Sbjct 33598790
AGTCCTTGTCAACATGAAT-ATCCCCTCC-CAAATTTTGGTCTCTTAATCTACCAACCTC 33598733

Query 411
CGTGAAATCAAT-ATCCCGCACAAGAGTGCTA-CTCTCCTCGCTCCGGGCCCATAACACT 468 || |||||| || ||||| | | |||| ||| || ||||||||||||||||||||||||
Sbjct 33598732
CGAGAAATC-ATCATCCCACTCGGGAGTACTACCT-TCCTCGCTCCGGGCCCATAACACT 33598675

Query 469
TGGGGGT-AGCTAAAGTGAA-CTGTATCC-GACATCTGGTTCCTACTTCAGGGCCATAAA 525 ||||||| | ||| | |||| || || || | |||||||||| ||| |||||||||||||
Sbjct 33598674
TGGGGGTGA-CTATACTGAAACTATA-CCTGGCATCTGGTTCTTACCTCAGGGCCATAAA 33598617

Query 526
GCCTAA-ATAGCCCACACGTTCCCCTTAAATAAGACATC 563 | ||| || | ||||||||||| |||||||||||||||
Sbjct 33598616
AC-TAAGATCGACCACACGTTCCTCTTAAATAAGACATC 33598579

>ref|NW_001838859.2| Homo sapiens chromosome 2 genomic contig, alternate assembly HuRef SCAF_1103279188159,
whole genome shotgun sequence Length=17647273

Features flanking this part of subject sequence: 63247 bp at 5' side: rho GTPase-activating protein 15 49827 bp at 3' side: kynureninase isoform a

Score = 169 bits (91), Expect = 1e-40
Identities = 220/279 (79%), Gaps = 21/279 (8%)
Strand=Plus/Plus

Query 296
CTTAACAGTACATAGTACATAAAGCCA-TTT-ACCGTACATAGCACATTACAGTCAAATC 353 ||||| | ||||||||||||||| | ||| | || |||||||||||| ||||||||
Sbjct 5848331
CTTAATATTACATAGTACATAAA---ATTTTCATCGAACATAGCACATTTCAGTCAAAAA 5848387

Query 354
CCTTCTCGTCCCCATGGATGA-CCCC-CCTCAGATAGGGGTCCCTTGA-CCACCATCCTC 410 | || ||| |||| || | |||| || || || |||| ||| | | |||| ||||
Sbjct 5848388
AGTCCTTGTCAACATGAAT-ATCCCCTCC-CAAATTTTGGTCTCTTAATCTACCAACCTC 5848445

Query 411
CGTGAAATCAAT-ATCCCGCACAAGAGTGCTA-CTCTCCTCGCTCCGGGCCCATAACACT 468 || |||||| || ||||| | | |||| ||| || ||||||||||||||||||||||||
Sbjct 5848446
CGAGAAATC-ATCATCCCACTCGGGAGTACTACCT-TCCTCGCTCCGGGCCCATAACACT 5848503

Query 469
TGGGGGT-AGCTAAAGTGAA-CTGTATCC-GACATCTGGTTCCTACTTCAGGGCCATAAA 525 ||||||| | ||| | |||| || || || | |||||||||| ||| |||||||||||||
Sbjct 5848504
TGGGGGTGA-CTATACTGAAACTATA-CCTGGCATCTGGTTCTTACCTCAGGGCCATAAA 5848561

Query 526
GCCTAA-ATAGCCCACACGTTCCCCTTAAATAAGACATC 563 | ||| || | ||||||||||| |||||||||||||||
Sbjct 5848562
AC-TAAGATCGACCACACGTTCCTCTTAAATAAGACATC 5848599

>ref|NT_011786.16| Homo sapiens chromosome X genomic contig, GRCh37.p5
Primary Assembly Length=27775034

Features flanking this part of subject sequence:
   178059 bp at 5' side: DDB1- and CUL4-associated factor 12-like protein 1
   88912 bp at 3' side: hypothetical protein LOC100130613

Score =  158 bits (85),  Expect = 2e-37
Identities = 215/275 (78%), Gaps = 20/275 (7%)
Strand=Plus/Plus

Query  306
CATAGTACATAAAGCCATTTACCGTACATAGCACATTACAG-TC--AAATCCCTTCTCGT  362
                 ||||||||||| |  | || || | ||||||||||||  || ||  ||||||| | | ||
Sbjct  10132360  CATAGTACATATATTCGTTCACTGGACATAGCACATTTTAGTTCAAAAATCCC-T-T-GT  10132416

Query  363
CCCCATGGATGACCCCCCT--CAGATAGGGGTCCCTTGA-CCACCATCCTCCGTGAAATC  419
                 |  ||||||| | ||||||  || ||   |||| ||| | | |||| | |||| ||||||
Sbjct  10132417
CAACATGGAT-A-CCCCCTACCAAATTTTGGTCTCTTAATCTACCAACTTCCGGGAAATC  10132474

Query  420
AAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAG-  477
                  || |||||||    ||||||||| |||||||||  |||||||||| |||||||| | |
Sbjct  10132475
-ATCATCCCGCTTGGGAGTGCTACCCTCCTCGCTGTGGGCCCATAAAACTTGGGGAT-GA  10132532

Query  478
CTAAAGTG-AACTGTATCC-GACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAA-ATA  534
                 |||   || |||| || || | ||||| |||| |||||||||||||||||  |||| | |
Sbjct  10132533
CTATCCTGAAACTATA-CCGGGCATCTAGTTCTTACTTCAGGGCCATAAA-ACTAAGACA  10132590

Query  535
GCCCACACGTTCCCCTTAAATAAGACATCACGATG  569
                 ||||||||||||||||||||||||||||| |||||
Sbjct  10132591
GCCCACACGTTCCCCTTAAATAAGACATCTCGATG  10132625

>ref|NW_001842398.1| Homo sapiens chromosome X genomic contig, alternate assembly
HuRef SCAF_1103279188320,
whole genome shotgun sequence Length=5876486

Features flanking this part of subject sequence:
   177320 bp at 5' side: DDB1- and CUL4-associated factor 12-like protein 1
   90884 bp at 3' side: hypothetical protein LOC100130613

Score =  158 bits (85),  Expect = 2e-37
Identities = 215/275 (78%), Gaps = 20/275 (7%)
Strand=Plus/Plus

Query  306
CATAGTACATAAAGCCATTTACCGTACATAGCACATTACAG-TC--AAATCCCTTCTCGT  362
                ||||||||||| |  | || || | ||||||||||||  || ||  ||||||| | | ||
Sbjct  1453865  CATAGTACATATATTCGTTCACTGGACATAGCACATTTTAGTTCAAAAATCCC-T-T-GT  1453921

Query  363
CCCCATGGATGACCCCCCT--CAGATAGGGGTCCCTTGA-CCACCATCCTCCGTGAAATC  419
                |  ||||||| | ||||||  || ||   |||| ||| | | |||| | |||| ||||||
Sbjct  1453922
CAACATGGAT-A-CCCCCTACCAAATTTTGGTCTCTTAATCTACCAACTTCCGGGAAATC  1453979

Query  420
AAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAG-  477
                 || |||||||    ||||||||| |||||||||  |||||||||| |||||||| | |
Sbjct  1453980
-ATCATCCCGCTTGGGAGTGCTACCCTCCTCGCTGTGGGCCCATAAAACTTGGGGAT-GA  1454037

Query  478
CTAAAGTG-AACTGTATCC-GACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAA-ATA  534
                |||   || |||| || || | ||||| |||| |||||||||||||||||  |||| | |
Sbjct  1454038
CTATCCTGAAACTATA-CCGGGCATCTAGTTCTTACTTCAGGGCCATAAA-ACTAAGACA  1454095

Query  535
GCCCACACGTTCCCCTTAAATAAGACATCACGATG  569
                ||||||||||||||||||||||||||||| |||||
Sbjct  1454096
GCCCACACGTTCCCCTTAAATAAGACATCTCGATG  1454130

>ref|NT_006576.16| Homo sapiens chromosome 5 genomic contig, GRCh37.p5
Primary Assembly Length=46395641

Features flanking this part of subject sequence:
   720804 bp at 5' side: methionine synthase reductase isoform 1
   421878 bp at 3' side: semaphorin-5A precursor

Score =  150 bits (81),  Expect = 4e-35
Identities = 137/162 (85%), Gaps = 11/162 (7%)
Strand=Plus/Plus

Query  414
GAAATCAAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGG  472
                |||||| || ||||| | |  |||| |||||||||||||||||||||||| |||||||||
Sbjct  8610975
GAAATC-ATCATCCCACTCGGGAGTACTACTCTCCTCGCTCCGGGCCCATGACACTTGGG  8611033

Query  473
GGTAG-CTAAAGTG-AACTGTATCC-GACATCTGGTTCCTACTTCAGGGCCATA-AAGCC  528
                ||| | ||| | || |||| || || | |||||||||| ||||||||||||||| ||  |
Sbjct  8611034
GGT-GACTATACTGAAACTATA-CCTGGCATCTGGTTCTTACTTCAGGGCCATAGAA--C  8611089

Query  529
TAA-ATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG  569
                ||| || ||||||||||||||||||||||||||||  |||||
Sbjct  8611090
TAAGATCGCCCACACGTTCCCCTTAAATAAGACATGTCGATG  8611131

>ref|NW_001838927.1| Homo sapiens chromosome 5 genomic contig, alternate assembly
HuRef SCAF_1103279188109,
whole genome shotgun sequence Length=9770120

Features flanking this part of subject sequence:
   721027 bp at 5' side: methionine synthase reductase isoform 1
   425437 bp at 3' side: semaphorin-5A precursor

Score =  150 bits (81),  Expect = 4e-35
Identities = 137/162 (85%), Gaps = 11/162 (7%)
Strand=Plus/Plus

Query  414
GAAATCAAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGG  472
               |||||| || ||||| | |  |||| |||||||||||||||||||||||| |||||||||
Sbjct  878991
GAAATC-ATCATCCCACTCGGGAGTACTACTCTCCTCGCTCCGGGCCCATGACACTTGGG  879049

Query  473
GGTAG-CTAAAGTG-AACTGTATCC-GACATCTGGTTCCTACTTCAGGGCCATA-AAGCC  528
               ||| | ||| | || |||| || || | |||||||||| ||||||||||||||| ||  |
Sbjct  879050
GGT-GACTATACTGAAACTATA-CCTGGCATCTGGTTCTTACTTCAGGGCCATAGAA--C  879105

Query  529
TAA-ATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG  569
               ||| || ||||||||||||||||||||||||||||  |||||
Sbjct  879106
TAAGATCGCCCACACGTTCCCCTTAAATAAGACATGTCGATG  879147

>ref|NT_167190.1| Homo sapiens chromosome 11 genomic contig, GRCh37.p5
Primary Assembly Length=41593379

Features in this part of subject sequence:
   stress-induced-phosphoprotein 1

Score =  139 bits (75),  Expect = 8e-32
Identities = 144/175 (82%), Gaps = 13/175 (7%)
Strand=Plus/Plus

Query  402
ACCATCCTCCGTGAAATCAAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCC  460
                |||| |||||| |||||| ||  |||||| |  |||| ||||| || |||||||||||||
Sbjct  9260570
ACCAACCTCCGAGAAATC-ATCCTCCCGCTCGGGAGTACTACTGTCTTCGCTCCGGGCCC  9260628

Query  461
ATAACACTTGGGGGT-AGCTAAAG-TGAA-CTGTATCC-GACATCTGGTTCCTACTTCAG  516
                ||||||||||||||| | | ||   |||| || || || |  ||||||||| ||||||||
Sbjct  9260629
ATAACACTTGGGGGTGA-C-AATTCTGAAACTATA-CCTGGTATCTGGTTCTTACTTCAG  9260685

Query  517
GGCCATAAAGCCTAA-ATAGCCCACACGT-TCCCCTTAAATAAGACATCACGATG  569
                ||||||||| | ||| || |||||||| | ||||||||||||||||||| |||||
Sbjct  9260686
GGCCATAAAAC-TAAGATCGCCCACAC-TCTCCCCTTAAATAAGACATCTCGATG  9260738

>ref|NW_001838024.1| Homo sapiens chromosome 11 genomic contig, alternate assembly
HuRef SCAF_1103279181191,
whole genome shotgun sequence Length=3419993

Features in this part of subject sequence:
   stress-induced-phosphoprotein 1

Score =  139 bits (75),  Expect = 8e-32
Identities = 144/175 (82%), Gaps = 13/175 (7%)
Strand=Plus/Plus

Query  402
ACCATCCTCCGTGAAATCAAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCC  460
                |||| |||||| |||||| ||  |||||| |  |||| ||||| || |||||||||||||
Sbjct  3054650
ACCAACCTCCGAGAAATC-ATCCTCCCGCTCGGGAGTACTACTGTCTTCGCTCCGGGCCC  3054708

Query  461
ATAACACTTGGGGGT-AGCTAAAG-TGAA-CTGTATCC-GACATCTGGTTCCTACTTCAG  516
                ||||||||||||||| | | ||   |||| || || || |  ||||||||| ||||||||
Sbjct  3054709
ATAACACTTGGGGGTGA-C-AATTCTGAAACTATA-CCTGGTATCTGGTTCTTACTTCAG  3054765

Query  517
GGCCATAAAGCCTAA-ATAGCCCACACGT-TCCCCTTAAATAAGACATCACGATG  569
                ||||||||| | ||| || |||||||| | ||||||||||||||||||| |||||
Sbjct  3054766
GGCCATAAAAC-TAAGATCGCCCACAC-TCTCCCCTTAAATAAGACATCTCGATG  3054818

>ref|NT_016354.19| Homo sapiens chromosome 4 genomic contig, GRCh37.p5
Primary Assembly Length=115591997

Features flanking this part of subject sequence:
   1219591 bp at 5' side: bifunctional heparan sulfate N-deacetylase/N-sulfotransfe...
   787424 bp at 3' side: translocating chain-associated membrane protein 1-like 1

Score =  121 bits (65),  Expect = 3e-26
Identities = 188/244 (77%), Gaps = 22/244 (9%)
Strand=Plus/Plus

Query  331
ACATAGCACATTACAGTC---AAATCCCTTCTCGTCCCCATGGATGA-CCCCCCTCAGAT  386
                 |||||||||||| |||||   |||| ||  ||||||  |||| || | ||||  ||| ||
Sbjct  41765504
ACATAGCACATTTCAGTCAAGAAAT-CC--CTCGTCAACATGTAT-ATCCCCTATCAAAT  41765559

Query  387
AGGGGTCCCTTGA-CCACCATCCTCCGTGAAATCAAT-ATCCCGCACAAGAGT-GCTACT  443
                    | || ||| | | |||| || | | |||||| || ||||| | || |||| || ||
Sbjct  41765560
TTTGCTCTCTTAATCTACCAACCACTGAGAAATC-ATCATCCCTCTCAGGAGTGGC-ACC  41765617

Query  444
CTCCTCGCTCCGGGCCCATAACACTTGGGGGTAG-CTAAAGTG-AACTGTATCC-GACAT  500
                 ||||| | ||| ||||||| |||||||||||| | ||| | || |||  || || | |||
Sbjct  41765618
CTCCTGGTTCCAGGCCCATGACACTTGGGGGT-GACTATACTGAAACCATA-CCTGGCAT  41765675

Query  501
CTGGTTCCTACTTCAGGGCCATA-AAGCCTAA-ATAGCCCACACGTTCCCCTTAAATAAG  558
                 ||||||| ||||||||||||||| ||   ||| || ||||||||||||||||||||||||
Sbjct  41765676
CTGGTTCTTACTTCAGGGCCATAGAA--TTAAGATCGCCCACACGTTCCCCTTAAATAAG  41765733

Query  559
ACAT  562
                 ||||
Sbjct  41765734
ACAT  41765737

>ref|NW_001838915.1| Homo sapiens chromosome 4 genomic contig, alternate assembly
HuRef SCAF_1103279188399,
whole genome shotgun sequence Length=43867763

Features flanking this part of subject sequence:
   1219700 bp at 5' side: bifunctional heparan sulfate N-deacetylase/N-sulfotransfe...
   787313 bp at 3' side: translocating chain-associated membrane protein 1-like 1

Score =  121 bits (65),  Expect = 3e-26
Identities = 188/244 (77%), Gaps = 22/244 (9%)
Strand=Plus/Plus

Query  331
ACATAGCACATTACAGTC---AAATCCCTTCTCGTCCCCATGGATGA-CCCCCCTCAGAT  386
                 |||||||||||| |||||   |||| ||  ||||||  |||| || | ||||  ||| ||
Sbjct  41713520
ACATAGCACATTTCAGTCAAGAAAT-CC--CTCGTCAACATGTAT-ATCCCCTATCAAAT  41713575

Query  387
AGGGGTCCCTTGA-CCACCATCCTCCGTGAAATCAAT-ATCCCGCACAAGAGT-GCTACT  443
                    | || ||| | | |||| || | | |||||| || ||||| | || |||| || ||
Sbjct  41713576
TTTGCTCTCTTAATCTACCAACCACTGAGAAATC-ATCATCCCTCTCAGGAGTGGC-ACC  41713633

Query  444
CTCCTCGCTCCGGGCCCATAACACTTGGGGGTAG-CTAAAGTG-AACTGTATCC-GACAT  500
                 ||||| | ||| ||||||| |||||||||||| | ||| | || |||  || || | |||
Sbjct  41713634
CTCCTGGTTCCAGGCCCATGACACTTGGGGGT-GACTATACTGAAACCATA-CCTGGCAT  41713691

Query  501
CTGGTTCCTACTTCAGGGCCATA-AAGCCTAA-ATAGCCCACACGTTCCCCTTAAATAAG  558
                 ||||||| ||||||||||||||| ||   ||| || ||||||||||||||||||||||||
Sbjct  41713692
CTGGTTCTTACTTCAGGGCCATAGAA--TTAAGATCGCCCACACGTTCCCCTTAAATAAG  41713749

Query  559
ACAT  562
                 ||||
Sbjct  41713750
ACAT  41713753

>ref|NT_006051.18| Homo sapiens chromosome 4 genomic contig, GRCh37.p5
Primary Assembly Length=7320557

Features in this part of subject sequence:
   serine/threonine-protein kinase 32B

Score =  111 bits (60),  Expect = 2e-23
Identities = 142/181 (78%), Gaps = 7/181 (4%)
Strand=Plus/Plus

Query  296
CTTAACAGTACATAGTACATAAAGCCATTTAC-CGTACATAGCACATTACAGTCAAATCC  354
                ||||||| ||||||||||||  |  |||| ||  | |||||||||||| |||||||||||
Sbjct  3927621
CTTAACATTACATAGTACATTCATTCATTCACTAG-ACATAGCACATTTCAGTCAAATCC  3927679

Query  355
CTTCTCGTCCCCATGGATGACCCCCCT-CAGATAGGGGTCCCTTGA-CCACCATCCTCCG  412
                   ||| ||  ||||||| | || | | || ||   |||| ||| | | |||| ||||||
Sbjct  3927680
AACCTCATCAACATGGAT-ATCCTCTTCCATATTTTGGTCTCTTAATCTACCAACCTCCG  3927738

Query  413
TGAAATCAAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGG  471
                 |||||| || ||||| | || | ||| ||| ||||||||||||||||||||||||||||
Sbjct  3927739
AGAAATC-ATCATCCCACTCAGGCGTGTTACCCTCCTCGCTCCGGGCCCATAACACTTGG  3927797

Query  472
G  472
                |
Sbjct  3927798
G  3927798

>ref|NW_001838897.1| Homo sapiens chromosome 4 genomic contig, alternate assembly
HuRef SCAF_1103279183534,
whole genome shotgun sequence Length=2307959

Features in this part of subject sequence:
   serine/threonine-protein kinase 32B

Score =  111 bits (60),  Expect = 2e-23
Identities = 142/181 (78%), Gaps = 7/181 (4%)
Strand=Plus/Plus

Query  296
CTTAACAGTACATAGTACATAAAGCCATTTAC-CGTACATAGCACATTACAGTCAAATCC  354
                ||||||| ||||||||||||  |  |||| ||  | |||||||||||| |||||||||||
Sbjct  1587835
CTTAACATTACATAGTACATTCATTCATTCACTAG-ACATAGCACATTTCAGTCAAATCC  1587893

Query  355
CTTCTCGTCCCCATGGATGACCCCCCT-CAGATAGGGGTCCCTTGA-CCACCATCCTCCG  412
                   ||| ||  ||||||| | || | | || ||   |||| ||| | | |||| ||||||
Sbjct  1587894
AACCTCATCAACATGGAT-ATCCTCTTCCATATTTTGGTCTCTTAATCTACCAACCTCCG  1587952

Query  413
TGAAATCAAT-ATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGG  471
                 |||||| || ||||| | || | ||| ||| ||||||||||||||||||||||||||||
Sbjct  1587953
AGAAATC-ATCATCCCACTCAGGCGTGTTACCCTCCTCGCTCCGGGCCCATAACACTTGG  1588011

Query  472
G  472
                |
Sbjct  1588012
G  1588012

>ref|NW_001838021.1| Homo sapiens chromosome 11 genomic contig, alternate assembly
HuRef SCAF_1103279188167,
whole genome shotgun sequence Length=4230486

Features flanking this part of subject sequence:
   29749 bp at 5' side: E3 ubiquitin-protein ligase TRIM68
   4669 bp at 3' side: olfactory receptor 51D1

Score = 80.5 bits (43),  Expect = 5e-14
Identities = 43/43 (100%), Gaps = 0/43 (0%)
Strand=Plus/Minus

Query  422
TATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAA  464
               |||||||||||||||||||||||||||||||||||||||||||
Sbjct  284325
TATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAA  284283


  Database: alt_CRA_TCAGchr7v2_contig
    Posted date:  Oct 7, 2011  9:52 AM
  Number of letters in database: 155,379,839
  Number of sequences in database:  6

Lambda     K      H
    1.33    0.621     1.12
Gapped
Lambda     K      H
    1.28    0.460    0.850
Matrix: blastn matrix:1 -2
Gap Penalties: Existence: 0, Extension: 0
Number of Sequences: 6
Number of Hits to DB: 0
Number of extensions: 0
Number of successful extensions: 0
Number of sequences better than 10: 0
Number of HSP's better than 10 without gapping: 0
Number of HSP's gapped: 0
Number of HSP's successfully gapped: 0
Length of query: 569
Length of database: 155379839
Length adjustment: 26
Effective length of query: 543
Effective length of database: 155379683
Effective search space: 84371167869
Effective search space used: 84371167869
A: 0
X1: 18 (34.6 bits)
X2: 32 (59.1 bits)
X3: 54 (99.7 bits)
S1: 18 (34.4 bits)
S2: 18 (34.4 bits)

http://www.uniprot.org/docs/humpvar
(Reference).
http://www.uniprot.org/uniprot/Q5VU92
http://genatlas.medecine.univ-paris5.fr/fiche.php?symbol=MTRNR2L1
http://www.uniprot.org/uniprot/Q53QZ3
(This may account for my inherited asthma, cat allergy trait).
http://www.uniprot.org/uniprot/?query=kynureninase+isoform+b&sort=score

  • kynureninase isoform a & kynureninase isoform b are both features of my chromosome 2... "a" is Rhesus macaque; "b" is Human... I don't care for the sound of that; however, it wouldn't surprise me.  I always did say that I have enough "Aryan" genes in me, to make me a possible carrier of traits like Rhesus negative blood type.  As always, there seems to be a lot of confusion surrounding this issue, amongst the 'scientists' / 'geneticists'.  One source, uniprot, distinctly characterizes the two enzymes as coming from two different species (Homo Sapiens and Macacus); while other sources list both of them as Human.  I need to run a blast of Homo Sapiens (perhaps my own) DNA against the Macacus (although I believe I've done it once or twice already, wouldn't hurt to study it some more).
http://www.reasons.org/articles/chromosome-2-the-best-evidence-for-evolution
(An interesting explanation and viewpoint).

http://www.uniprot.org/uniprot/P31948
(stress-induced-phosphoprotein 1; apparently an antigen created by one or more of my ancestors' issues with renal function?  Also called, "renal carcinoma antigen".  I suppose it has protective attributes, unless it becomes overactive, in which case it might become some kind of autoimmune disease syndrome.)

http://www.uniprot.org/uniprot/Q8NGF3
(olfactory receptor 51D1; probably accounts for my acute sense of smell -- I'm always the first one in any crowd, to realize something isn't quite right: natural gas leaks, etc.  It probably also accounts at least partly, for my very weak stomach and very strong gag reflex.)

http://www.nextprot.org/db/entry/NX_Q6AZZ1
http://www.uniprot.org/uniprot/Q6AZZ1
(E3 ubiquitin-protein ligase TRIM68; a nuclear receptor that mediates the action of androgen... I think that must mean that it helps me to maintain my feminine qualities.)

These proteins, enzymes and antigens all seem to have health benefits.

NOTE:  The Chromosomes compared here are:  Mitochondria, X, 2, 4, 5, 11, 17.

I think it's very interesting and probably germaine to the issue of Human x Ape hybridization, that my Mitochondrial DNA displays 99% identities compared with the "standard" Human Genome.  All of the other chromosomes listed here (including my X chromosome) show substantially lower identies ratings:

Chromosome 2:   79%
Chromosome 4:   77%
Chromosome 5:   85%
Chromosome 11: 82%
Chromosome 17: 77%
Chromosome X:  78%

Which begs the question:  If the identities are to the Human Genome, then to what Species Genome(s) are the non-identities related?

No comments:

Post a Comment