Search This Blog

Saturday, January 14, 2012

Huntington's and Parkinson's Diseases and Memory Triggers

 Homo sapiens chromosome 11 genomic contig, alternate assembly
HuRef SCAF_1103279188167, whole genome shotgun sequence
Length=4230486


Features flanking this part of subject sequence:
   29749 bp at 5' side: E3 ubiquitin-protein ligase TRIM68
   4669 bp at 3' side: olfactory receptor 51D1

Score = 80.5 bits (43),  Expect = 5e-14
Identities = 43/43 (100%), Gaps = 0/43 (0%)
Strand=Plus/Minus

Query  422     TATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAA  464
               |||||||||||||||||||||||||||||||||||||||||||
Sbjct  284325  TATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAA  284283

I BLASTed my mtDNA against the standard Human Genome, and got the above result for a section of chromosome 11.  It looks like a complete match, but I'm not sure what the implications are here.  Evidently, the olfactory receptor 51D1 is a "Human" trait.  And the ubiquitin-protein ligase enzyme is associated with Parkinson's and Huntington's diseases; and with ubiquitin-mediated proteolysis (which I gather is the body's method of biologically controlling the beneficial processes of cell destruction).

I'm not sure what this means for me specifically, except that the fact that these two items appeared in my BLAST, while others didn't, suggests that I might have a genetic predisposition to these particular traits...

This information (whether or not accurately interpreted by me) has triggered a memory in me.  I remember my father telling me that he ~thought it was possible that my grandfather (Vernon Denman) had been committed to the state mental hospital in Arcadia, Florida, at the time -- for either Huntington's or Parkinson's disease.

For what it's worth, I am fairly certain now, that he either ~had one of those inherited conditions (along with asthma), OR, that the medical establishment nevertheless had ~diagnosed him with one of them.

Both are inherited diseases, and I think my father actually told me it was one or the other, but I can't remember precisely which one he mentioned, due to the fact that both are so closely related to the other.  Of course, my father was very young when his dad died, and his death plus 'societies' handling of it, traumatized him emotionally.  So even though he shared the information with me, he never felt really sure about anything, regarding his father's alleged "suicide" by "poisoning".

My father wanted answers which he never got satisfactorily, in his lifetime.  He sought the ~truth of the matter.  He wasn't content to simply accept what was alleged by medical, social, government,  or justice 'authorities' about his father, whom he probably would have better known than anyone, other than his mother, Vernon's ex-wife.  He wasn't in any position to know for certain what REALLY happened down there in Arcadia, many miles away from home.  He only knew that his gut instinct told him that something was very wrong with the story.  It didn't add up, somehow.

Unfortunately, my father (who lived a very healthy lifestyle, btw) died young of a massive double stroke (the second one ocurring in the ER or hospital), and isn't here to help me find the answers.  And it now looks like I might not live long enough either, to see justice done for Vernon, my father, myself, and really our whole family, bottom line.

I just wonder how many people's lives and families have been destroyed by our government, with the aid and abetment of the 'medical establishment', 'doctors', FDA, pharmaceutical corporations, etc.?  How many more of us, innocent and trusting souls, must perish, before justice is done, and people and our civil rights are finally ~protected under the law?

What use are laws, if they don't protect the innocent and guiltless victims of crimes?  What use are laws which only protect the guilty and the socially, politically powerful?

UPDATE: Ok, I didn't think it was 'Parkinson's' (what Muhammed Ali and Michael J. Fox suffer from).  That typically strikes people over the age of 50.
http://en.wikipedia.org/wiki/Parkinson%27s_disease#Risk_factors

This article describes Huntington's chorea as a catastropically destructive inherited disease, which may strike either men or women.  I know of no other people in my family, with the disease. None.  So, I don't really understand how my grandfather could have had it.  But if I am a carrier of the gene (I'm not sure), that means it runs in the family, so I suppose anything is possible.

The article also states as one of the symptoms of the condition, that sufferers are more prone to "suicidal thoughts" and suicide attempts.  But, how the hell do they know what another person is ~thinking -- unless they're informed by the person thinking it?

When I was very sick with double ear infections, last March, April, and May... I went into the local ER where I received deplorable 'treatment' (neglect and mental abuse, is all I got there; they trolled me).  "Yeah, it's puss-y," the first doctor commented, when looking at my ear.  I'd been going in and out of physical ~shock, I had told them.

On the third and final visit (I'll just die now, rather than vainly expect real treatment at the local ER),  a self-piercing 'doctor' with 2-3 large earrings in each of his ears, asked just out of the blue and very coyly, if I was going to kill myself ("do something to yourself"), since they were refusing to acknowledge or help me in any way.  "Why would I come here (to a hospital ER) for medical attention, if I wanted to die?" I replied.

I went in 3 times (desperate for help, I was dying), each time receiving only abuse, neglect, and humiliation; then billed for over $550 worth of nonservice and malicious practice, EACH time.  Also, strangely (since they claimed my illness was all in my mind, without any testing to prove or disprove an infection, although at least one of them saw the "puss" in my ear) -- they referred me to local Ear, Nose, and Throat ~specialists, for further evaluations...

They knew I had no health insurance; I had told them that the illness was preventing me from being gainfully employed.  I had told them that it was due to a recently acquired underlying, mysterious immune deficiency, that suddenly appeared, imediately following my pre-employment physical at the local "Veterans' Affairs" psychiatric hospital (station number 666).  I can hardly wait to see what sort of garbage is recorded by the Hybrids, in my online (and hardcopy) medical files.
http://en.wikipedia.org/wiki/Huntington%27s_disease

No comments:

Post a Comment