Search This Blog

Monday, January 9, 2012

ftDNA's Contradictory findings Concerning my mtDNA Haplogroup Classification

http://vps1.jameslick.com/dna/mthap/mthap.cgi

Hi James, first of all thanks for providing the public with this awesome tool for checking mtDNA --I know that you're quite busy, and apologize for being a bit 'difficult' (lol); but maybe you can help me understand why ftDNA first reported my HVR1 results as belonging in mtDNA haplogroup "X", then 3 1/2 yrs later sent me an email informing me that it has been 'updated' to "W" (which is now what they show on my account over there).

However, when comparing with the 13 closest matches there, only mine and some "X"s on the list have the 16189T mutation on them: none of the "W"s have that.  Mine is also the only one on the list of 14 similars, with 6 mutations (the rest have 5 or less on their HVR1s).

Also, as you might see from the report I got from your website (above linked), your program also lists me as an "X".

Naturally that's all very confusing for me, but I would like to know... In your ~opinion and based on the HVR1 alone, do you think that my mtDNA is more "X" or "W"?

ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTA
CCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATT
ACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTG
TAGTACATAAAAACCCAATCCACATCAAAACCCCCCCCCCATGCTTACAAG
CAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAACTCCAAAG
CCACCCCTCACCCACTAGGATATCAACAAACCTACCTACTCTTAACAGTAC
ATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCACCATCC
TCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCC
CATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTA
CTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACA
TCACGATG

I just noticed something new on ftDNA too: I now have one complete match there (Terri Harmon Dean, no other info other than a contact email; also reported as a "W").  (The Genographic Project, where I submitted my sample in 2006, also mirrored ftDNA's conclusions - first "X", then later "W".  However, the 'Project had referred me to ftDNA from the beginning anyway, to retrieve the original testing results.)

Yet on ~mitosearch, this person isn't listed on my comparison data:

http://www.mitosearch.org/search_results.asp?comparison_type=Standard&uid=59FZA

Somehow I intuitively felt that I should double-check their contradictory findings; what do you think about it?

Thanks,

3 comments:

  1. This comment has been removed by a blog administrator.

    ReplyDelete
  2. You are probably W1e1 according to the current haplogroup reference.

    ReplyDelete
    Replies
    1. Thanks James. It seems awfully rare though; I can't find any information about it online, so far. I don't think it helps much either, how the haplotypes have had to be reclassified again and again. Creating so much confusion, which I'm sure works to the advantage of some people. In order to effectively study my haplotype, I need a list of ALL of its previous official classifications... all the way back to 2006 "X". It's happened so often, I can barely list them all.

      Delete